Angelic/Angelic Translations

This page contains various Angelic language translations for instances found in NieR Replicant ver.1.22474487139..., NieR:Automata, and NieR Reincarnation.

NieR Replicant ver.1.22474487139...[]

Example	Image	Angelic	Translation
Title Screen Idle Movie #1			NieR Replicant^[1]
Title Screen Idle Movie #1		1400	mirai 1400 nen^{[Note 1]}^[2]
Title Screen Idle Movie #1			horobiru sekai^{[Note 2]}^[3]
Title Screen Idle Movie #2			NieR^[1]
Title Screen Idle Movie #2			hito saigo^{[Note 3]}
Song of the Ancients Mural		() ()	[W]hen the grea[t] black book Grimoire Noir The white book Grimoire Weis^[sic] will appear with his Sealed Verses He will then use them to vanquish Grimoire Noir and purge the calamity^{[Note 4]}^[4]
Black Scrawl			GTCA (generic)^{[Note 5]}
Dark Wall (Level 1)			kindness responsibility affection
Dark Wall (Level 2)			kindness responsibility affection friendship stubbornness kindness responsibility^{[Note 4]}
Dark Wall (Level 3)	Original Mirrored		(mirrored) kindness responsibility affection friendship stubbornness kindness responsibility affection friendship stubbornness kindness^{[Note 4]}
Dark Whirlwind Spheres			kizuna bonds (repeated x4)^{[Note 6]}
Kainé's Magic Circle (Inner)			I will never forget your kindness (repeated)
Kainé's Magic Circle (Outer)			I will never forget your kindness (repeated)
Wendy's Shell 5-tier Circle		() () () () () () () ()	remorse (repeated) solitude (repeated) uneasiness (repeated) emptiness (repeated) distress (repeated) remorse remorse remorse remorse [solitu]de solitude solitude solitude solitude solitude so[litude] [unea]siness uneasiness uneas^[sic] uneasiness uneasiness uneasiness une[asiness] [emptine]ss emptiness emptines[s] [dist]ress distress dist[ress]^{[Note 4]}
Wendy's Shell 4-tier Circle		() () ()	anger (repeated) chagrin (repeated) regret (repeated) repentance (repeated) anger ange^[sic] anger anger anger anger anger chagrin chagr^[sic] chagrin chagrin chagrin chagrin chagrin chagrin [r]egret regret regret reg[ret] repentance repentanc[e]^{[Note 4]}
Wendy shell, edge joint 2-tier Circle		()	grudge (repeated) shyness (repeated) grudge grudge grudge [shy]ness shyness shyness shyness^{[Note 4]}
Wendy's Shell 1-tier Circle			remorse (repeated)^{[Note 4]}
Wendy's Shell Edge Joint			PSBL PYX PSBBL PYX (unknown)
Wendy's Shell Edge Joint			PLIPIT (unknown)
Wendy's Eye			uneasiness (repeated) uneasiness (repeated) uneasiness (repeated) emptiness (repeated) distress (repeated)^{[Note 4]}
Inventory Screen (Key Fragments)		? ? ? ? ?	ACGT (generic)^{[Note 7]} TCTCTCAGGCCCATGGCCCA CTGACACTCCTGTAGGGGTAGAAGAC??CAGAACCT ? TGTTGTGTC A ?CGTGGTGGC C AGCTGATAG T GCCAA?ATC C CACTTTGCC^{[Note 4]}
Grimoire Weiss Right Page (1/2)
Grimoire Weiss Right Page (1/2)		Such a strange group for fight shadow^[sic] Don t you think Like this rude woman in her undergarments She shouldn t be allowed to fight Shadow^[sic] dressed like this Whatever And you my friend You are an exceedingly stubborn boy And you still call me with that name Instead to refer to me by me^[sic] full And proper name By the heavens I have never been Treated in such a manner I am a being of incalculable importance And yet you approach me as A common cockbook^[sic]^{[Note 8]} You know that don t you Oh man how many fates should I accept Here with you guys Does it have an end Perhaps that s why I m enjoying Our journey together And boy I hope at the end of this We can help your sister Such a strange group for fighting shadows, don't you think? Like this rude woman in her undergarments. She shouldn't be allowed to fight shadows dressed like this! Whatever. And you, my friend... You are an exceedingly stubborn boy. And you still call me with that name, instead of referring to me by my full and proper name. By the heavens, I have never been treated in such a manner. I am a being of incalculable importance, and yet you approach me as a common cockroach? You know that don't you? Oh man, how many fates should I accept here with you guys. Does it have an end? Perhaps that's why I'm enjoying our journey together. And boy, I hope at the end of this we can help your sister.
Grimoire Weiss Left Page (2/2)
Grimoire Weiss Left Page (2/2)		Bwah hah hah I am Grimoire Weiss My very name brings Kingdoms to their knees I will grant you one final chance Bow your head and accept my power Or go it alone and fail That was our first meet Can you remember boy After that we used to spend Long days together Fight^[sic] shadows deliver letters Help random people and Medding^[sic] in people s affairs It seems some headstrong idiot Has decided to push me Beyond my limits I should have taken that job As a cookbook when I had the chance You humans certainly are so complex Maybe I m rude or kinda pretentious But to be honest I can t understand You humans very well Maybe I will huh "Bwah hah hah! I am Grimoire Weiss! My very name brings kingdoms to their knees! I will grant you one final chance. Bow your head and accept my power, or go it alone and fail." That was our first meet. Can you remember, boy? After that, we used to spend long days together; Fighting shadows, delivering letters, helping random people, and meddling in people's affairs. It seems some headstrong idiot has decided to push me beyond my limits. I should have taken that job as a cookbook when I had the chance. You humans certainly are so complex. Maybe I'm rude, or kinda pretentious... But to be honest, I can't understand you humans very well. Maybe I will, huh?
Grimoire Noir Right Page (1/2)
Grimoire Noir Right Page (1/2)		Much time has passed since The red dragon fell from the sky I can still remember that feeling When sky^[sic] started crying tears of ash And now here we are Tears won t stop people are Sick and everyone is dying I have to do something Shades just keep coming We are hiding but We can t stay like this forever I can t surrender now I have to keep going Forever Much time has passed since the red dragon fell from the sky. I can still remember that feeling when [the] sky started crying tears of ash... And now, here we are. [The] tears won't stop. People are sick and everyone is dying. I have to do something. Shades just keep coming. We are hiding, but we can't stay like this forever... I can't surrender now. I have to keep going. Forever.
Grimoire Noir Left Page (2/2)
Grimoire Noir Left Page (2/2)		This city has changed so much After that snow of salt fell Shades are everywhere and It s all fault of this black book Shades keep screaming sometimes Seems they just cry Some days ago I saw it They were hugging each other Maybe even if they have become shades They can still remember about their human past Well For killed them I am No way they are just shades I wont let em hurt her This city has changed so much after that snow of salt fell. Shades are everywhere, and it's all [the] fault of this black book. Shades keep screaming. Sometimes [it] seems they just cry... Some days ago I saw it: They were hugging each other. Maybe even if they have become shades, they can still remember about their human past... Well, for killing them, I am... No way! They are just shades. I won't let them hurt her!
Grimoire Rubrum Right Page			side effect ACGT (generic, repeated)^{[Note 7]}
Grimoire Rubrum Left Page			research report about power of petrification ACGT (generic, repeated)^{[Note 7]}
Dialogue Boxes Ending E			Kaine stop cant go back

NieR:Automata[]

Example	Image	Angelic	Translation
Title Screen Idle Movie			YoRHa Truth
R010: Laser Impact			ACGT (generic)
R030: Hammer Impact			ACGT (generic)
A110: Slow Area			ACGT (generic)
A140: Gravity Area			ACGT (generic)
Boss Bar (Route A)			Marx
Boss Bar (Route A)			Engels
Boss Bar (Route A)			Adam
Boss Bar (Route A)			Simone
Boss Bar (Route A)			So Shi (So-Shi)
Boss Bar (Route A)			Boku shi (Boku-Shi)
Meat Box Entrance			Meat Box
Soul Box Entrance			Soul Box
God Box Entrance			God Box
3C3C1D119440927 DLC Icon			downloadcontents (Download Contents)

NieR Reincarnation[]

Example	Angelic	Translation
Opening Cinematic	'	The Cage Sin's resting place
Opening Cinematic		Weapons Vessels of the mind
Golden Door (Summoning)		concealed weapons hidden memories sealed sins (repeated x2)
Recollections of Dusk Portrait Background (EX Character Quests Submenu)		C O M I N G S OO N (Coming Soon)
The Sun and the Moon Teaser Chalkboard	?? -- - - - ? ? -? ?	ACGT (generic)^{[Note 7]} CA TAGC AGCT GCTAG TAGCT GT??CATATCACAGTCGAGCCGA C -- CGATCG CGATT C- -ATCGCAT ATA- GCTAGT?T AATGTCGT G ACTAGCA ATG AAGTCGT ?CTGC -A?CTA TAGCTA? A
The Sun and the Moon Opening Cinematic		Tokyo
The Sun and the Moon Opening Cinematic		Light Soul
The Sun and the Moon Opening Cinematic		Dark Soul
The Sun and the Moon Obelisk	. ,
The Sun and the Moon Obelisk	Welcome the fates of your souls will now be tested. To you who possesses the soul of the sun please proceed to the white door to you who possesses the soul of the moon please proceed to the black door but do not fear for even if you should meet a most bitter and tragic end, your souls will always know reincarnation Welcome. The fates of your souls will now be tested. To you who possesses the soul of the sun, please proceed to the white door. To you who possesses the soul of the moon, please proceed to the black door. But do not fear, for even if you should meet a most bitter and tragic end, your souls will always know reincarnation.
Magick Circle (The Sun and the Moon, Binding Magick)		Blessing of the Witch (repeated x4)
Red Eye Crown (Yuzuki EX Story)	- ?- -	Heart TheWrath Red TheMoon God Legions End Sacrilege King Avenge Th- ?- -nge
SINoALICE Crossover Trailer (Fabled Witch)	. ' , ( ) . () , -	I had a weird dream. I couldn't walk anymore, so I had t[o crawl] on the ground like a baby. The girls came to me and screamed th[ere] was a monster, -ed me^[5]
SINoALICE Crossover Trailer (Fabled Weapon)	- , - - - . -, - -	Little Red Riding Hood - born of various stories, -ing Swedish folk tales -es of Mother -y Charles Perrault. -ble, -in -ales^[5]
SINoALICE Crossover Trailer (Fabled Assassin)	, - -( ) . ( , ())	In a distant past, a princess came to an army -he verge -[of an]nihilation brought them victory after victory. [She became on object of worship, but was then crucified as a criminal after a def[eat]]^[5]

The People and the World[]

Example	Angelic	Translation
Finale Sealing Rune		out of the loop (repeated) hide my mind from the world (repeated) out of the loop (repeated) frozen time as my heart^[sic] (repeated)^{[Note 4]}
Finale Boss Mist		People
Finale Boss Mist		And
Finale Boss Mist		World
Finale Boss Mist		Out
Epilogue Top Menu	999	Stamina 999 Notices Gift Box Shop Missions Pass Friends Help
Epilogue Library Menu	Main Story	Main Story Character EX Character Event Extra Encyclopedia Cutscenes
Epilogue Bottom Menu	Library	Top Loadout Enhance Quests Map Library Summons Menu
Post-Game Encyclopedia Entry		Fio TheGirlOfLight (The Girl of Light)

Notes[]

↑ Rōmaji mirai 1400 nen (未来１４００年), meaning "1400 years in the future."
↑ Rōmaji horobiru sekai (滅びる世界), meaning "world nearing destruction."
↑ Rōmaji hito saigo (人最期), meaning "man's end."
↑ ^4.00 ^4.01 ^4.02 ^4.03 ^4.04 ^4.05 ^4.06 ^4.07 ^4.08 ^4.09 Read from innermost to outermost ring.
↑ DNA sequencing, referring to guanine (G), thymine (T), cytosine (C), and adenine (A). Some instances are mirrored.
↑ Rōmaji kizuna (絆), meaning "emotional bond."
↑ ^7.0 ^7.1 ^7.2 ^7.3 DNA sequencing, referring to adenine (A), cytosine (C), guanine (G), and thymine (T). Randomized arrangement.
↑ Likely a combination of "cockroach" (from original quote) and "cookbook" (a separate quote).

References[]

↑ ^1.0 ^1.1 Translated during idle movie.
↑ JP Subtitles: 「１４００年後の未来」
EN Subtitles: "1400 years in the future..."
↑ JP Subtitles: 「滅びる世界」
EN Subtitles: "The world is on the verge of destruction..."
↑ "When the great black book, Grimoire Noir, brings calamity upon the world... The white book, Grimoire Weiss, will appear with his Sealed Verses. He will then use them to vanquish Grimoire Noir and purge the calamity he wrought. Or so the legend goes." - Popola (NieR Replicant ver.1.22474487139...)
↑ ^5.0 ^5.1 ^5.2 Translated during trailer.

[2] Rōmaji mirai 1400 nen (未来１４００年), meaning "1400 years in the future."

[4] Rōmaji horobiru sekai (滅びる世界), meaning "world nearing destruction."

[6] Rōmaji hito saigo (人最期), meaning "man's end."

[innerouter-7] 4.00 ^4.01 ^4.02 ^4.03 ^4.04 ^4.05 ^4.06 ^4.07 ^4.08 ^4.09 Read from innermost to outermost ring.

[9] DNA sequencing, referring to guanine (G), thymine (T), cytosine (C), and adenine (A). Some instances are mirrored.

[10] Rōmaji kizuna (絆), meaning "emotional bond."

[dna-11] 7.0 ^7.1 ^7.2 ^7.3 DNA sequencing, referring to adenine (A), cytosine (C), guanine (G), and thymine (T). Randomized arrangement.

[12] Likely a combination of "cockroach" (from original quote) and "cookbook" (a separate quote).

[idle-1] 1.0 ^1.1 Translated during idle movie.

[3] JP Subtitles: 「１４００年後の未来」
EN Subtitles: "1400 years in the future..."

[5] JP Subtitles: 「滅びる世界」
EN Subtitles: "The world is on the verge of destruction..."

[8] "When the great black book, Grimoire Noir, brings calamity upon the world... The white book, Grimoire Weiss, will appear with his Sealed Verses. He will then use them to vanquish Grimoire Noir and purge the calamity he wrought. Or so the legend goes." - Popola (NieR Replicant ver.1.22474487139...)

[trailer-13] 5.0 ^5.1 ^5.2 Translated during trailer.

[1]

[Note 1]

[2]

[Note 2]

[3]

[Note 3]

[Note 4]

[4]

[Note 5]

[Note 6]

[Note 7]

[Note 8]

[5]